Review



gene names  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 92
      Buy from Supplier

    Structured Review

    ATCC gene names
    Gene Names, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene names/product/ATCC
    Average 92 stars, based on 21 article reviews
    gene names - by Bioz Stars, 2026-02
    92/100 stars

    Images



    Similar Products

    gene names  (ATCC)
    92
    ATCC gene names
    Gene Names, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene names/product/ATCC
    Average 92 stars, based on 1 article reviews
    gene names - by Bioz Stars, 2026-02
    92/100 stars
    		  Buy from Supplier
    strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id  (ATCC)
    90
    ATCC strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id
    Strain Gene Name Accession Polypeptide Arthrobacter Aurescens Dsm Hyuc Seq Id, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id/product/ATCC
    Average 90 stars, based on 1 article reviews
    strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    b kit name human calcitonin gene related peptide  (Cusabio)
    93
    Cusabio b kit name human calcitonin gene related peptide
    B Kit Name Human Calcitonin Gene Related Peptide, supplied by Cusabio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/b kit name human calcitonin gene related peptide/product/Cusabio
    Average 93 stars, based on 1 article reviews
    b kit name human calcitonin gene related peptide - by Bioz Stars, 2026-02
    93/100 stars
    		  Buy from Supplier
    oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10)  (Oligos Etc)
    90
    Oligos Etc oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10)
    Oligo Gene Name Sequence (5’ 3’) Gyra Gyra For Ttgaaggaggaactcttgatgg (Seq Id No: 10), supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10)/product/Oligos Etc
    Average 90 stars, based on 1 article reviews
    oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10) - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    chrom./gene name  (Chrom Tech)
    90
    Chrom Tech chrom./gene name
    Chrom./Gene Name, supplied by Chrom Tech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/chrom./gene name/product/Chrom Tech
    Average 90 stars, based on 1 article reviews
    chrom./gene name - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    protein mapping to uniprot ids and gene names  (SomaLogic)
    90
    SomaLogic protein mapping to uniprot ids and gene names
    Protein Mapping To Uniprot Ids And Gene Names, supplied by SomaLogic, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/protein mapping to uniprot ids and gene names/product/SomaLogic
    Average 90 stars, based on 1 article reviews
    protein mapping to uniprot ids and gene names - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    aspergillus niger atcc 1015 gene name aspnidraft 214857 ec 3 1 1 11  (ATCC)
    97
    ATCC aspergillus niger atcc 1015 gene name aspnidraft 214857 ec 3 1 1 11
    Aspergillus Niger Atcc 1015 Gene Name Aspnidraft 214857 Ec 3 1 1 11, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aspergillus niger atcc 1015 gene name aspnidraft 214857 ec 3 1 1 11/product/ATCC
    Average 97 stars, based on 1 article reviews
    aspergillus niger atcc 1015 gene name aspnidraft 214857 ec 3 1 1 11 - by Bioz Stars, 2026-02
    97/100 stars
    		  Buy from Supplier
    reference orf gene name blast best hi  (Unigene)
    90
    Unigene reference orf gene name blast best hi
    Reference Orf Gene Name Blast Best Hi, supplied by Unigene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reference orf gene name blast best hi/product/Unigene
    Average 90 stars, based on 1 article reviews
    reference orf gene name blast best hi - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    real time primers gene names primer sequences (5'→3)  (Real Time Primers)
    90
    Real Time Primers real time primers gene names primer sequences (5'→3)
    Real Time Primers Gene Names Primer Sequences (5'→3), supplied by Real Time Primers, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time primers gene names primer sequences (5'→3)/product/Real Time Primers
    Average 90 stars, based on 1 article reviews
    real time primers gene names primer sequences (5'→3) - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier

    Image Search Results